Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768312

Xenopus ORFeome
What is the ORFeome?

ORF Name:nosip ORF1 Species: tropicalis
Gene Symbol: nosip Entrez Gene ID: 394625
Gene Synonyms:
Gene Name: nitric oxide synthase interacting protein
Description: Uncharacterized conserved protein
Plate: GDExt11009 Well: H05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133460.1
ORF Translation: ATO94812.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis nitric oxide synthase interacting protein, mRNA (cDNA clone MGC:75989 IMAGE:5384403), complete cds
Template Accession: BC061402
GI: 38174117
Clone ID: IMAGE:5384403
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAAGGCATGGGAAAAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCCTGCATTACTGGCCG


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556