Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768517

Xenopus ORFeome
What is the ORFeome?

ORF Name:ntrk2 ORF1 Species: tropicalis
Gene Symbol: ntrk2 Entrez Gene ID: 780110
Gene Synonyms: ntrk2-a, ntrk2-b, trkb, xtrkb
Gene Name: neurotrophic receptor tyrosine kinase 2
Description: nerve growth factor receptor
Plate: GDExt11032 Well: C02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135304.1
ORF Translation: ATO96656.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis neurotrophic tyrosine kinase, receptor, type 2, mRNA (cDNA clone MGC:145900 IMAGE:7658458), complete cds
Template Accession: BC123936
GI: 115312894
Clone ID: IMAGE:7658458
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGCCTCTGGAAAGGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCAAGGATATCAAGGTATACA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556