Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768632

Xenopus ORFeome
What is the ORFeome?

ORF Name:oaz1 ORF1 Species: tropicalis
Gene Symbol: oaz1 Entrez Gene ID: 394475
Gene Synonyms: odc-az
Gene Name: ornithine decarboxylase antizyme 1
Description: enzyme inhibitor
Plate: GDExt11004 Well: E02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132916.1
ORF Translation: ATO94268.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ornithine decarboxylase antizyme 1, mRNA (cDNA clone MGC:75770 IMAGE:5381834), complete cds
Template Accession: BC059754
GI: 37590428
Clone ID: IMAGE:5381834
Tissue: whole organism
Stage: NF stage 40 to NF stage 45
Clone Library: NICHD_XGC_Emb8
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTCTCCGAACATTCAGAT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTTCATCAGAAGAATCTCTTTC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556