Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768637

Xenopus ORFeome
What is the ORFeome?

ORF Name:odc1 ORF1 Species: tropicalis
Gene Symbol: odc1 Entrez Gene ID: 448028
Gene Synonyms: odc, ornithine decarboxylase, xodc1
Gene Name: ornithine decarboxylase 1
Description: rate-limiting enzyme, polyamine biosynthesis pathway
Plate: GDExt11009 Well: D02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133408.1
ORF Translation: ATO94760.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ornithine decarboxylase 1, mRNA (cDNA clone MGC:69433 IMAGE:5335701), complete cds
Template Accession: BC074547
GI: 49257729
Clone ID: IMAGE:5335701
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACAGCTTCAGCAATGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATACGTTGATGCTGGCAGTAGGA


Publications
First:
Most recent:
View All Papers