Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768677

Xenopus ORFeome
What is the ORFeome?

ORF Name:olfml3 ORF1 Species: tropicalis
Gene Symbol: olfml3 Entrez Gene ID: 779771
Gene Synonyms: ont1
Gene Name: olfactomedin like 3
Description: Olfactomedin and related extracellular matrix glycoproteins
Plate: GDExt11033 Well: E01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135354.1
ORF Translation: ATO96706.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis olfactomedin-like 3, mRNA (cDNA clone MGC:145952 IMAGE:7664120), complete cds
Template Accession: BC121380
GI: 111305622
Clone ID: IMAGE:7664120
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGATTGTGGCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAAAGTTCATCTCTGTGTTTC


Publications
First:
Most recent:
View All Papers