Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768682

Xenopus ORFeome
What is the ORFeome?

ORF Name:olig3 ORF1 Species: tropicalis
Gene Symbol: olig3 Entrez Gene ID: 493553
Gene Synonyms:
Gene Name: oligodendrocyte transcription factor 3
Description: transcription factor
Plate: GDExt11013 Well: F03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133793.1
ORF Translation: ATO95145.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis oligodendrocyte transcription factor 3, mRNA (cDNA clone MGC:89336 IMAGE:6987669), complete cds
Template Accession: BC082516
GI: 51950123
Clone ID: IMAGE:6987669
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTCTGATTCCAGCTCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCAGCAAGTCTTTGGTTTCTG


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556