Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768803

Xenopus ORFeome
What is the ORFeome?

ORF Name:otx2 ORF1 Species: tropicalis
Gene Symbol: otx2 Entrez Gene ID: 548931
Gene Synonyms: otx-2, otx2-a, otx2-b, otxa, xotx-2, xotx2
Gene Name: orthodenticle homeobox 2
Description: homeodomain transcription factor
Plate: GDExt11045 Well: H10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136388.1
ORF Translation: ATO97740.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis orthodenticle homeobox 2, mRNA (cDNA clone MGC:121624 IMAGE:7624050), complete cds
Template Accession: BC135884
GI: 134025766
Clone ID: IMAGE:7624050
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGTCTTATCTCAAGCAACC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAACCTGGAACTTCCATGA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556