Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768853

Xenopus ORFeome
What is the ORFeome?

ORF Name:p2ry2 ORF1 Species: tropicalis
Gene Symbol: p2ry2 Entrez Gene ID: 394636
Gene Synonyms:
Gene Name: purinergic receptor P2Y, G-protein coupled, 2
Description: Glycoprotein hormone receptor
Plate: GDExt11004 Well: C09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133000.1
ORF Translation: ATO94352.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis purinergic receptor P2Y, G-protein coupled, 2, mRNA (cDNA clone MGC:75941 IMAGE:5383884), complete cds
Template Accession: BC061378
GI: 38174095
Clone ID: IMAGE:5383884
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACGCGTCTGGAGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTTGCTAATTACAGCCG


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556