Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768858

Xenopus ORFeome
What is the ORFeome?

ORF Name:p2ry4 ORF1 Species: tropicalis
Gene Symbol: p2ry4 Entrez Gene ID: 595021
Gene Synonyms: xlp2y
Gene Name: pyrimidinergic receptor P2Y, G-protein coupled, 4
Description: G protein-coupled receptor
Plate: GDExt11021 Well: D02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134469.1
ORF Translation: ATO95821.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis MGC97549 protein, mRNA (cDNA clone MGC:97549 IMAGE:5383970), complete cds
Template Accession: BC091589
GI: 60550946
Clone ID: IMAGE:5383970
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGTGGCATCATGGCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTTTTGGAATGTTCTGCAGCTC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556