Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768863

Xenopus ORFeome
What is the ORFeome?

ORF Name:p3h1 ORF1 Species: tropicalis
Gene Symbol: p3h1 Entrez Gene ID: 100036679
Gene Synonyms: lepre1, leprecan
Gene Name: prolyl 3-hydroxylase 1
Description: Membrane-associated proteoglycan Leprecan
Plate: GDExt11027 Well: D11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135007.1
ORF Translation: ATO96359.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100036679, mRNA (cDNA clone MGC:145415 IMAGE:7680578), complete cds
Template Accession: BC128622
GI: 118763633
Clone ID: IMAGE:7680578
Tissue: testis
Stage:
Clone Library: NIH_XGC_tropTe3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGTCCTTGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATTCTGTCTTGGGTTTGGAGT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556