Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768868

Xenopus ORFeome
What is the ORFeome?

ORF Name:paaf1 ORF1 Species: tropicalis
Gene Symbol: paaf1 Entrez Gene ID: 779683
Gene Synonyms: paaf, rpn14, wdr71
Gene Name: proteasomal ATPase associated factor 1
Description: WD40 repeat-containing protein
Plate: GDExt11046 Well: D08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136443.1
ORF Translation: ATO97795.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis proteasomal ATPase-associated factor 1, mRNA (cDNA clone MGC:146521 IMAGE:7797229), complete cds
Template Accession: BC118827
GI: 110645624
Clone ID: IMAGE:7797229
Tissue: whole organism
Stage: NF stage 62
Clone Library: NIH_XGC_tropMet5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTCTCCATACAGGGGGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTACCTGGAACACGGGTTGTCT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556