Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19769332

Xenopus ORFeome
What is the ORFeome?

ORF Name:pglyrp1 ORF1 Species: tropicalis
Gene Symbol: pglyrp1 Entrez Gene ID: 548492
Gene Synonyms: mgc108469, pgrp-s
Gene Name: peptidoglycan recognition protein 1
Description:
Plate: GDExt11025 Well: H07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134847.1
ORF Translation: ATO96199.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis peptidoglycan recognition protein 1, mRNA (cDNA clone MGC:108330 IMAGE:7022325), complete cds
Template Accession: BC089715
GI: 58477697
Clone ID: IMAGE:7022325
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCGTCTTCTTGCGATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCTTGGAAGCGGGGCCAAGT


Publications
First:
Most recent:
View All Papers