Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19769432

Xenopus ORFeome
What is the ORFeome?

ORF Name:pias2 ORF1 Species: tropicalis
Gene Symbol: pias2 Entrez Gene ID: 779910
Gene Synonyms:
Gene Name: protein inhibitor of activated STAT 2
Description: zinc finger transcription factor
Plate: GDExt11032 Well: A03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135284.1
ORF Translation: ATO96636.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis protein inhibitor of activated STAT, 2, mRNA (cDNA clone MGC:145235 IMAGE:7657842), complete cds
Template Accession: BC121854
GI: 112419328
Clone ID: IMAGE:7657842
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGACACCGAGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACGAATCTGGAGGCATGTGAA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556