Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19769445

Xenopus ORFeome
What is the ORFeome?

ORF Name:pigc ORF1 Species: tropicalis
Gene Symbol: Entrez Gene ID:
Gene Synonyms:
Gene Name:
Description:
Plate: GDExt11038 Well: E01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135759.1
ORF Translation: ATO97111.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC549879, mRNA (cDNA clone MGC:122509 IMAGE:7653092), complete cds
Template Accession: BC135977
GI: 134025599
Clone ID: IMAGE:7653092
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCCAGTGCTGCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCAAGGAAGCGAGAAAGATC


Publications
First:
Most recent:
View All Papers