Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19769610

Xenopus ORFeome
What is the ORFeome?

ORF Name:plekho2 ORF1 Species: tropicalis
Gene Symbol: plekho2 Entrez Gene ID: 100127744
Gene Synonyms: plekhq1, pp1628, pp9099
Gene Name: pleckstrin homology domain containing O2
Description:
Plate: GDExt11048 Well: F09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136620.1
ORF Translation: ATO97972.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100127744, mRNA (cDNA clone MGC:181308 IMAGE:8929283), complete cds
Template Accession: BC154931
GI: 159156028
Clone ID: IMAGE:8929283
Tissue: thymus
Stage: frog
Clone Library: NICHD_XGC_tropThy1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGATGGTGAGAAGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGGACACTTCTCCTGTA


Publications
First:
Most recent:
View All Papers