Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19769630

Xenopus ORFeome
What is the ORFeome?

ORF Name:plp1 ORF1 Species: tropicalis
Gene Symbol: plp1 Entrez Gene ID: 613099
Gene Synonyms: hld1, mmpl, plp, plp1-a, plp1-b, pmd, spg2
Gene Name: proteolipid protein 1
Description: Neuronal membrane glycoprotein/Myelin proteolipid protein
Plate: GDExt11022 Well: E09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134633.1
ORF Translation: ATO95985.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein mgc107988, mRNA (cDNA clone MGC:107988 IMAGE:6998135), complete cds
Template Accession: BC098089
GI: 67867473
Clone ID: IMAGE:6998135
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTTGGCATGATGGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAACTTTGAGCGATCGCTCC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556