Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19769735

Xenopus ORFeome
What is the ORFeome?

ORF Name:pnp ORF1 Species: tropicalis
Gene Symbol: pnp Entrez Gene ID: 448370
Gene Synonyms: nucleoside phosphorylase, punp
Gene Name: purine nucleoside phosphorylase
Description: Purine nucleoside phosphorylase
Plate: GDExt11023 Well: F01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134567.1
ORF Translation: ATO95919.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis nucleoside phosphorylase, mRNA (cDNA clone MGC:89242 IMAGE:7018104), complete cds
Template Accession: BC075454
GI: 49523036
Clone ID: IMAGE:7018104
Tissue: whole organism
Stage: frog
Clone Library: NICHD_XGC_Swb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGCCTCCCGCCCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTGATTTAGGTTCAGGTGTT


Publications
First:
Most recent:
View All Papers