Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770010

Xenopus ORFeome
What is the ORFeome?

ORF Name:ppp2ca ORF1 Species: tropicalis
Gene Symbol: ppp2ca Entrez Gene ID: 394888
Gene Synonyms: mgc147335, mgc53449, mgc69362, pp2ac
Gene Name: protein phosphatase 2 catalytic subunit alpha
Description: serine/threonine protein phosphatase
Plate: GDExt11003 Well: E02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132873.1
ORF Translation: ATO94225.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform, mRNA (cDNA clone MGC:75638 IMAGE:5379510), complete cds
Template Accession: BC064168
GI: 39795763
Clone ID: IMAGE:5379510
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGAAAAGGCGTTCACGAAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGAAGTAGTCGGGTGT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556