Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770025

Xenopus ORFeome
What is the ORFeome?

ORF Name:ppp2r1a ORF1 Species: tropicalis
Gene Symbol: ppp2r1a Entrez Gene ID: 395042
Gene Synonyms: pp2a-aalpha, pp2aaalpha, ppp2r1a-a, ppp2r1a-b, pr65a
Gene Name: protein phosphatase 2 regulatory subunit A, alpha
Description: Protein phosphatase 2A regulatory subunit A and related proteins
Plate: GDExt11001 Well: A09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132750.1
ORF Translation: ATO94102.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein MGC76072, mRNA (cDNA clone MGC:76072 IMAGE:5307699), complete cds
Template Accession: BC064863
GI: 40787738
Clone ID: IMAGE:5307699
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGGCAGACGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACGCCAAAGCCAGCACTGTA


Publications
First:
Most recent:
View All Papers