Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770150

Xenopus ORFeome
What is the ORFeome?

ORF Name:prelid2 ORF1 Species: tropicalis
Gene Symbol: prelid2 Entrez Gene ID: 549676
Gene Synonyms:
Gene Name: PRELI domain containing 2
Description: Predicted member of the intramitochondrial sorting protein family
Plate: GDExt11026 Well: C09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134945.1
ORF Translation: ATO96297.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC549676, mRNA (cDNA clone MGC:108370 IMAGE:7023510), complete cds
Template Accession: BC091072
GI: 60688410
Clone ID: IMAGE:7023510
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGATCGCCGTGGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGAAAGGGCAGCCACA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556