Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770175

Xenopus ORFeome
What is the ORFeome?

ORF Name:prkar1b ORF1 Species: tropicalis
Gene Symbol: prkar1b Entrez Gene ID: 780384
Gene Synonyms: prkar1
Gene Name: protein kinase, cAMP-dependent, regulatory subunit type I beta
Description:
Plate: GDExt11032 Well: E01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135311.1
ORF Translation: ATO96663.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis protein kinase, cAMP dependent regulatory, type I beta, mRNA (cDNA clone MGC:145205 IMAGE:7654593), complete cds
Template Accession: BC121849
GI: 112418471
Clone ID: IMAGE:7654593
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTTCTTCCTCATC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACAGTGAGAGAAATGAAGCTGTT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556