Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770200

Xenopus ORFeome
What is the ORFeome?

ORF Name:prmt1 ORF1 Species: tropicalis
Gene Symbol: prmt1 Entrez Gene ID: 448086
Gene Synonyms: 3e10, anm1, hcp1, hrmt1l2, ir1b4, prmt1-a, prmt1-b, xprmt1, xprmt1, xprmt1b
Gene Name: protein arginine methyltransferase 1
Description: methyltransferase
Plate: GDExt11008 Well: F06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133402.1
ORF Translation: ATO94754.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis protein arginine methyltransferase 1, mRNA (cDNA clone MGC:69475 IMAGE:5336129), complete cds
Template Accession: BC074614
GI: 49257755
Clone ID: IMAGE:5336129
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGTTTCTTGTACTCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGCATTCTGTAGTCTGTC


Publications
First:
Most recent:
View All Papers