Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770230

Xenopus ORFeome
What is the ORFeome?

ORF Name:prph ORF1 Species: tropicalis
Gene Symbol: prph Entrez Gene ID: 407916
Gene Synonyms: nef4, peripherin, xif3
Gene Name: peripherin
Description: intermediate filament
Plate: GDExt11008 Well: F12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133364.1
ORF Translation: ATO94716.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis peripherin, mRNA (cDNA clone MGC:69454 IMAGE:5335951), complete cds
Template Accession: BC067967
GI: 49250507
Clone ID: IMAGE:5335951
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCACTCTGGTCTGAGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTCTCCTTCTGAGGAC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556