Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770260

Xenopus ORFeome
What is the ORFeome?

ORF Name:prrg4 ORF1 Species: tropicalis
Gene Symbol: prrg2 Entrez Gene ID: 448457
Gene Synonyms: prgp4, prrg4, tmg4
Gene Name: proline rich Gla (G-carboxyglutamic acid) 2 (transmembrane)
Description: Trypsin
Plate: GDExt11015 Well: C09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133923.1
ORF Translation: ATO95275.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane), mRNA (cDNA clone MGC:89526 IMAGE:6993041), complete cds
Template Accession: BC075566
GI: 49523076
Clone ID: IMAGE:6993041
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGCTGATCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTCGGCTGATTCGATCT


Publications
First:
Most recent:
View All Papers