Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770370

Xenopus ORFeome
What is the ORFeome?

ORF Name:psmb8 ORF1 Species: tropicalis
Gene Symbol: psmb8 Entrez Gene ID: 445258
Gene Synonyms: lmp7, low molecular mass protein-7 (lmp-7) homolog
Gene Name: proteasome subunit beta 8
Description: 20S proteasome, regulatory subunit
Plate: GDExt11049 Well: B02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136685.1
ORF Translation: ATO98037.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7), mRNA (cDNA clone MGC:181155 IMAGE:8903851), complete cds
Template Accession: BC153713
GI: 157423122
Clone ID: IMAGE:8903851
Tissue: tail
Stage: NF stage 55 to NF stage 66
Clone Library: NICHD_XGC_tropTail_m
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACTTCTCACCATCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGTTCTTCTCTTCAGT


Publications
First:
Most recent:
View All Papers