Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770725

Xenopus ORFeome
What is the ORFeome?

ORF Name:rab3d ORF1 Species: tropicalis
Gene Symbol: rab3d Entrez Gene ID: 448064
Gene Synonyms: rab16, rab3d-a, rab3d-b, rad3d
Gene Name: RAB3D, member RAS oncogene family
Description: small GTPase
Plate: GDExt11007 Well: D02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133237.1
ORF Translation: ATO94589.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis RAB3D, member RAS oncogene family, mRNA (cDNA clone MGC:69316 IMAGE:5308773), complete cds
Template Accession: BC074589
GI: 49257745
Clone ID: IMAGE:5308773
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATCAGCCAATGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGGAGCAGTTGCTGTGTT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556