Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770765

Xenopus ORFeome
What is the ORFeome?

ORF Name:rab7a ORF1 Species: tropicalis
Gene Symbol: rab7a Entrez Gene ID: 493388
Gene Synonyms: mgc80674, rab7
Gene Name: RAB7A, member RAS oncogene family
Description: small GTPase
Plate: GDExt11011 Well: E03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133557.1
ORF Translation: ATO94909.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis RAB7A, member RAS oncogene family, mRNA (cDNA clone MGC:79525 IMAGE:6977707), complete cds
Template Accession: BC080905
GI: 51704076
Clone ID: IMAGE:6977707
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACGTCCAGGAAGAAAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGCTGCAGCTCTCGG


Publications
First:
Most recent:
View All Papers