Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770770

Xenopus ORFeome
What is the ORFeome?

ORF Name:rab7b ORF1 Species: tropicalis
Gene Symbol: rab7b Entrez Gene ID: 100124979
Gene Synonyms: loc100124979
Gene Name: RAB7B, member RAS oncogene family
Description: Ras-related GTPase
Plate: GDExt11045 Well: C04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136313.1
ORF Translation: ATO97665.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100124979, mRNA (cDNA clone MGC:121771 IMAGE:7633601), complete cds
Template Accession: BC135955
GI: 134023972
Clone ID: IMAGE:7633601
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTCTGGAAATAAAGTGGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGCATGTGCTACTGTGA


Publications
First:
Most recent:
View All Papers