Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770780

Xenopus ORFeome
What is the ORFeome?

ORF Name:rab9a ORF1 Species: tropicalis
Gene Symbol: rab9a Entrez Gene ID: 780093
Gene Synonyms: rab9a-a, rab9a-b
Gene Name: RAB9A, member RAS oncogene family
Description: small GTPase
Plate: GDExt11037 Well: D02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135700.1
ORF Translation: ATO97052.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis RAB9A, member RAS oncogene family, mRNA (cDNA clone MGC:147337 IMAGE:7868619), complete cds
Template Accession: BC123091
GI: 116063510
Clone ID: IMAGE:7868619
Tissue: skin
Stage:
Clone Library: NIH_XGC_tropSki1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGCCAAATCCTCACT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGCAAGCAGTAGTTGG


Publications
First:
Most recent:
View All Papers