Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19770830

Xenopus ORFeome
What is the ORFeome?

ORF Name:racgap1 ORF1 Species: tropicalis
Gene Symbol: racgap1 Entrez Gene ID: 407917
Gene Synonyms: cyk-4, id-gap, mgcracgap
Gene Name: Rac GTPase activating protein 1
Description: GTPase-activating protein
Plate: GDExt11007 Well: F09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133300.1
ORF Translation: ATO94652.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis Rac GTPase activating protein 1, mRNA (cDNA clone MGC:69444 IMAGE:5335860), complete cds
Template Accession: BC067994
GI: 49250502
Clone ID: IMAGE:5335860
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGACAAACCTGATGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTAAGCAGAGGGGAGGCGA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556