Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19771145

Xenopus ORFeome
What is the ORFeome?

ORF Name:rcvrn.2 ORF1 Species: tropicalis
Gene Symbol: rcvrn.2 Entrez Gene ID: 493526
Gene Synonyms: rcv1, rcvrn.2-a, rcvrn.2-b, recoverin
Gene Name: recoverin, gene 2
Description: neuronal calcium sensor similar to recoverin
Plate: GDExt11012 Well: D05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133669.1
ORF Translation: ATO95021.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis MGC79749 protein, mRNA (cDNA clone MGC:79749 IMAGE:6983689), complete cds
Template Accession: BC082346
GI: 51949977
Clone ID: IMAGE:6983689
Tissue: whole organism
Stage: NF stage 40 to NF stage 45
Clone Library: NICHD_XGC_Emb8
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAACACCAAGAGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTTTCTTGGGTCGTACTGAAT


Publications
First:
Most recent:
View All Papers