Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19771195

Xenopus ORFeome
What is the ORFeome?

ORF Name:rem1 ORF1 Species: tropicalis
Gene Symbol: rem1 Entrez Gene ID: 100124825
Gene Synonyms: ges, rem
Gene Name: RAS (RAD and GEM)-like GTP-binding 1
Description: GTPase
Plate: GDExt11043 Well: E08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136205.1
ORF Translation: ATO97557.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis RAS (RAD and GEM)-like GTP-binding 1, mRNA (cDNA clone MGC:121535 IMAGE:7617051), complete cds
Template Accession: BC135453
GI: 134025758
Clone ID: IMAGE:7617051
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGCGCCTCACGAGCTCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGCACGGACAGATCATGG


Publications
First:
Most recent:
View All Papers