Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19771440

Xenopus ORFeome
What is the ORFeome?

ORF Name:rnf13 ORF1 Species: tropicalis
Gene Symbol: rnf13 Entrez Gene ID: 493377
Gene Synonyms:
Gene Name: ring finger protein 13
Description: mediator of ubiquitin ligase activity
Plate: GDExt11010 Well: G09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133541.1
ORF Translation: ATO94893.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ring finger protein 13, mRNA (cDNA clone MGC:79504 IMAGE:6977064), complete cds
Template Accession: BC080893
GI: 51704074
Clone ID: IMAGE:6977064
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGACATTCAGGATGTGCGTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACAGTATTCCTTTCCCTGGAC


Publications
First:
Most recent:
View All Papers