Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19771545

Xenopus ORFeome
What is the ORFeome?

ORF Name:rnpep ORF1 Species: tropicalis
Gene Symbol: rnpep Entrez Gene ID: 407876
Gene Synonyms:
Gene Name: arginyl aminopeptidase (aminopeptidase B)
Description: Bifunctional leukotriene A4 hydrolase/aminopeptidase LTA4H
Plate: GDExt11006 Well: G11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133198.1
ORF Translation: ATO94550.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis arginyl aminopeptidase (aminopeptidase B), mRNA (cDNA clone MGC:69297 IMAGE:5308559), complete cds
Template Accession: BC067945
GI: 45709771
Clone ID: IMAGE:5308559
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGCCAGAGGCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTTCCTAGGATCCTCTTTACAT


Publications
First:
Most recent:
View All Papers