Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19771625

Xenopus ORFeome
What is the ORFeome?

ORF Name:rpl18 ORF1 Species: tropicalis
Gene Symbol: rpl18 Entrez Gene ID: 496439
Gene Synonyms: rpl18-a, rpl18-b
Gene Name: ribosomal protein L18
Description: 60s ribosomal protein L18
Plate: GDExt11006 Well: F01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133126.1
ORF Translation: ATO94478.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ribosomal protein L18, mRNA (cDNA clone MGC:89878 IMAGE:7029272), complete cds
Template Accession: BC082960
GI: 52354735
Clone ID: IMAGE:7029272
Tissue: whole organism
Stage: NF stage 10 to NF stage 29 and 30
Clone Library: XtSt10-30
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGTAGATATCCGTCACAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCTTGTATCCTCTGCTGGCT


Publications
First:
Most recent:
View All Papers