Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19771635

Xenopus ORFeome
What is the ORFeome?

ORF Name:rpl22 ORF1 Species: tropicalis
Gene Symbol: rpl22 Entrez Gene ID: 549409
Gene Synonyms:
Gene Name: ribosomal protein L22
Description: 60S ribosomal protein L22
Plate: GDExt11043 Well: E04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136171.1
ORF Translation: ATO97523.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC549409, mRNA (cDNA clone MGC:121344 IMAGE:7604714), complete cds
Template Accession: BC135496
GI: 134254243
Clone ID: IMAGE:7604714
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCCTGTGAAGAAGACCGTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTTCATCTTCTTCCTCCTC


Publications
First:
Most recent:
View All Papers