Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19771905

Xenopus ORFeome
What is the ORFeome?

ORF Name:rpsa ORF1 Species: tropicalis
Gene Symbol: rpsa Entrez Gene ID: 394665
Gene Synonyms: 37-kd lr, 37lrp, 67-kd lr, lambr, laminin receptor, lamr1, lr, lrp, p40
Gene Name: ribosomal protein SA
Description: 40S ribosomal protein SA (P40)/Laminin receptor 1
Plate: GDExt11003 Well: B06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132930.1
ORF Translation: ATO94282.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ribosomal protein SA, mRNA (cDNA clone MGC:75768 IMAGE:5381822), complete cds
Template Accession: BC061298
GI: 38174037
Clone ID: IMAGE:5381822
Tissue: whole organism
Stage: NF stage 40 to NF stage 45
Clone Library: NICHD_XGC_Emb8
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGGAGGTCTTGATGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACCACTCAGTAGTGGTT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556