Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19772235

Xenopus ORFeome
What is the ORFeome?

ORF Name:sec14l1 ORF1 Species: tropicalis
Gene Symbol: sec14l1 Entrez Gene ID: 100124776
Gene Synonyms:
Gene Name: SEC14-like lipid binding 1
Description: transporter
Plate: GDExt11039 Well: F12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135925.1
ORF Translation: ATO97277.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis SEC14-like 1, mRNA (cDNA clone MGC:146514 IMAGE:7794610), complete cds
Template Accession: BC121463
GI: 111306110
Clone ID: IMAGE:7794610
Tissue: testis
Stage: frog
Clone Library: NIH_XGC_tropTe4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCAGAAGTACCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTGGAGATGAGGGAGCTGCTGT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556