Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19772265

Xenopus ORFeome
What is the ORFeome?

ORF Name:sec63 ORF1 Species: tropicalis
Gene Symbol: sec63 Entrez Gene ID: 100125094
Gene Synonyms:
Gene Name: SEC63 homolog, protein translocation regulator
Description: molecular chaperone, endoplasmic reticulum translocon component
Plate: GDExt11039 Well: B04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135811.1
ORF Translation: ATO97163.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100125094, mRNA (cDNA clone MGC:122944 IMAGE:7670074), complete cds
Template Accession: BC136214
GI: 134026275
Clone ID: IMAGE:7670074
Tissue: brain
Stage:
Clone Library: NIH_XGC_tropBrn4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGGGCAACAGTTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAACTACTTACCACAACAACA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556