Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19772550

Xenopus ORFeome
What is the ORFeome?

ORF Name:six6 ORF1 Species: tropicalis
Gene Symbol: six6 Entrez Gene ID: 100101705
Gene Synonyms: hpe2, optic six gene 2, optx2, six6.1, six6.2, xoptx2, xsix3, xsix6, xsix6.1, xsix6.2
Gene Name: SIX homeobox 6
Description: homeodomain transcription factor
Plate: GDExt11045 Well: E01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136361.1
ORF Translation: ATO97713.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis SIX homeobox 6, mRNA (cDNA clone MGC:122113 IMAGE:7623919), complete cds
Template Accession: BC135852
GI: 134024104
Clone ID: IMAGE:7623919
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTCAGCTGCCTATTCTGAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGTCACATTCACTGTCGCT


Publications
First:
Most recent:
View All Papers