Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19772595

Xenopus ORFeome
What is the ORFeome?

ORF Name:slc17a5 ORF1 Species: tropicalis
Gene Symbol: slc17a5 Entrez Gene ID: 780284
Gene Synonyms:
Gene Name: solute carrier family 17 member 5
Description: transmembrane solute exchange
Plate: GDExt11036 Well: C07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135684.1
ORF Translation: ATO97036.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis solute carrier family 17 (anion/sugar transporter), member 5, mRNA (cDNA clone MGC:147538 IMAGE:7858210), complete cds
Template Accession: BC121681
GI: 111305814
Clone ID: IMAGE:7858210
Tissue: oviduct
Stage:
Clone Library: NIH_XGC_tropOvi1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGAGAAGGGACAGCGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGTCCTCTTCTGTGTT


Publications
First:
Most recent:
View All Papers