Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19772905

Xenopus ORFeome
What is the ORFeome?

ORF Name:slc5a6 ORF1 Species: tropicalis
Gene Symbol: slc5a6 Entrez Gene ID: 448188
Gene Synonyms:
Gene Name: solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6
Description: Na+:iodide/myo-inositol/multivitamin symporters
Plate: GDExt11012 Well: D11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133686.1
ORF Translation: ATO95038.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis solute carrier family 5 (sodium-dependent vitamin transporter), member 6, mRNA (cDNA clone MGC:79691 IMAGE:6980848), complete cds
Template Accession: BC075109
GI: 49522065
Clone ID: IMAGE:6980848
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGTTCACCACTGTGGACTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTGAGAGCTCCGCTGAA


Publications
First:
Most recent:
View All Papers