Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19772910

Xenopus ORFeome
What is the ORFeome?

ORF Name:slc5a8 ORF1 Species: tropicalis
Gene Symbol: eif2s2 Entrez Gene ID: 112694769
Gene Synonyms:
Gene Name: eukaryotic translation initiation factor 2 subunit beta
Description: Translation initiation factor 2, beta subunit (eIF-2beta)
Plate: GDExt11002 Well: C10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132879.1
ORF Translation: ATO94231.1

Full-Length Confidence: good



Template Information
Description: BC061598.1 Xenopus tropicalis solute carrier family 5 (iodide transporter), member 8, mRNA (cDNA clone MGC:75629 IMAGE:5379403), complete cds
Template Accession: BC061598
GI: 38181841
Clone ID: IMAGE:5379403
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGGAGACGAGATGATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGGCTTTGGCACGGA


Publications
First:
Most recent:
View All Papers