Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19772965

Xenopus ORFeome
What is the ORFeome?

ORF Name:smad2 ORF1 Species: tropicalis
Gene Symbol: smad2 Entrez Gene ID: 496586
Gene Synonyms: smad-2, xsmad2
Gene Name: SMAD family member 2
Description: signal transduction, TGF-beta pathway
Plate: GDExt11020 Well: A08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134350.1
ORF Translation: ATO95702.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis SMAD family member 2, mRNA (cDNA clone MGC:89473 IMAGE:6991760), complete cds
Template Accession: BC084994
GI: 54648023
Clone ID: IMAGE:6991760
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTCCATTTTGCCATTTACC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGACATGCTTGAGCAGCGCAC


Publications
First:
Most recent:
View All Papers