Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19773040

Xenopus ORFeome
What is the ORFeome?

ORF Name:snai1 ORF1 Species: tropicalis
Gene Symbol: snai1 Entrez Gene ID: 394880
Gene Synonyms: sna, snail, snail1, xsna, xsnail
Gene Name: snail family zinc finger 1
Description: zinc finger transcriptional repressor
Plate: GDExt11001 Well: C03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132726.1
ORF Translation: ATO94078.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis snail homolog 1, mRNA (cDNA clone MGC:76142 IMAGE:5335209), complete cds
Template Accession: BC064223
GI: 39795794
Clone ID: IMAGE:5335209
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGCGGTCATTCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGGCTCCCGTGCACC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556