Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19773045

Xenopus ORFeome
What is the ORFeome?

ORF Name:snai2 ORF1 Species: tropicalis
Gene Symbol: snai2 Entrez Gene ID: 395065
Gene Synonyms: slug, snai2-a, snai2-b, snail2, xslu, xslug, xsnail2
Gene Name: snail family zinc finger 2
Description: zinc finger transcriptional repressor
Plate: GDExt11017 Well: E05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134095.1
ORF Translation: ATO95447.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis snail homolog 2, mRNA (cDNA clone MGC:89094 IMAGE:7006382), complete cds
Template Accession: BC075376
GI: 49522371
Clone ID: IMAGE:7006382
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACGATCTTTTCTGGTCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTGCTACACAACAACCAGA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556