Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19773220

Xenopus ORFeome
What is the ORFeome?

ORF Name:sox11 ORF1 Species: tropicalis
Gene Symbol: sox11 Entrez Gene ID: 493415
Gene Synonyms: sox11-a, sox11-b, xls13, xls13a, xls13b, xsox-11, xsox11
Gene Name: SRY-box 11
Description: HMG-box transcription factor
Plate: GDExt11012 Well: G02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133610.1
ORF Translation: ATO94962.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis SRY (sex determining region Y)-box 11, mRNA (cDNA clone MGC:79621 IMAGE:6979794), complete cds
Template Accession: BC080939
GI: 51703666
Clone ID: IMAGE:6979794
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCAGCAAGCCGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAAGTGAATACCAAGTCTGAAAA


Publications
First:
Most recent:
View All Papers