Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19773250

Xenopus ORFeome
What is the ORFeome?

ORF Name:sox3 ORF1 Species: tropicalis
Gene Symbol: sox3 Entrez Gene ID: 493228
Gene Synonyms: sry, xlsox3, xsox3, xtsox3
Gene Name: SRY-box 3
Description: HMG-box transcription factor
Plate: GDExt11012 Well: B03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133637.1
ORF Translation: ATO94989.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis SRY (sex determining region Y)-box 3, mRNA (cDNA clone MGC:79596 IMAGE:6979162), complete cds
Template Accession: BC079938
GI: 51261383
Clone ID: IMAGE:6979162
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATAGCATGTTGGACACAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATATGTGAGTGAGCGGTACAG


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556