Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19773265

Xenopus ORFeome
What is the ORFeome?

ORF Name:sp1 ORF1 Species: tropicalis
Gene Symbol: sp1 Entrez Gene ID: 394744
Gene Synonyms:
Gene Name: Sp1 transcription factor
Description: zinc finger transcription factor
Plate: GDExt11009 Well: H06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133472.1
ORF Translation: ATO94824.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis Sp1 transcription factor, mRNA (cDNA clone MGC:76006 IMAGE:5384614), complete cds
Template Accession: BC061414
GI: 38511775
Clone ID: IMAGE:5384614
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCGATCAGGAGCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTTATAGTACCACTGGCAA


Publications
First:
Most recent:
View All Papers