Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19774040

Xenopus ORFeome
What is the ORFeome?

ORF Name:tbx3 ORF1 Species: tropicalis
Gene Symbol: tbx3 Entrez Gene ID: 613116
Gene Synonyms: tbx3-a, tbx3-b, xltbx3, xtbx3
Gene Name: T-box 3
Description: T-box transcription factor
Plate: GDExt11022 Well: B04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134501.1
ORF Translation: ATO95853.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis T-box 3, mRNA (cDNA clone MGC:97730 IMAGE:6986826), complete cds
Template Accession: BC099621
GI: 68534664
Clone ID: IMAGE:6986826
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTTACCCATGAGAGATCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCAGGGGAACCGCTCCTT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556